Skip to main content

bowtie

Versions and Availability

▶ Display Module Names for bowtie on all clusters.

▶ Module FAQ?

▶ Did not find the version you want to use??

About the Software

Bowtie is an ultrafast, memory-efficient short read aligner for short DNA sequences (reads) from next-gen sequencers.

Usage

bowtie --help  for command line options

e.g., bowtie -c prefix-index-file GCGTGAGCTATGAGAAAGCGCCACGCTTCC
      bowtie prefix-index-file reads.fq

      bowtie-build seq.fna index-file  
   

Resources

Last modified: September 10 2020 11:58:50.