Skip to main content

bowtie2

Versions and Availability

▶ Display Module Names for bowtie2 on all clusters.

▶ Module FAQ?

▶ Did not find the version you want to use??

About the Software

Bowtie 2 is an ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences

Usage

bowtie --help  for command line options

e.g., bowtie2 -c prefix-index-file GCGTGAGCTATGAGAAAGCGCCACGCTTCC
      bowtie2 prefix-index-file reads.fq

      bowtie2-build seq.fna index-file 
 

Resources

Last modified: September 10 2020 11:58:50.