Skip to main content



Bowtie2 is an ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences. It is particularly good at aligning reads of about 50 up to 100s or 1,000s of characters, and particularly good at aligning to relatively long (e.g. mammalian) genomes. Bowtie 2 indexes the genome with an FM Index to keep its memory footprint small: for the human genome, its memory footprint is typically around 3.2 GB. Bowtie 2 supports gapped, local, and paired-end alignment modes.

Versions and Availability

Module Names for bowtie2 on qb2
Machine Version Module Name
None Available N/A N/A
▶ Module FAQ?

The information here is applicable to LSU HPC and LONI systems.


A user may choose between using /bin/bash and /bin/tcsh. Details about each shell follows.


System resource file: /etc/profile

When one access the shell, the following user files are read in if they exist (in order):

  1. ~/.bash_profile (anything sent to STDOUT or STDERR will cause things like rsync to break)
  2. ~/.bashrc (interactive login only)
  3. ~/.profile

When a user logs out of an interactive session, the file ~/.bash_logout is executed if it exists.

The default value of the environmental variable, PATH, is set automatically using SoftEnv. See below for more information.


The file ~/.cshrc is used to customize the user's environment if his login shell is /bin/tcsh.


Modules is a utility which helps users manage the complex business of setting up their shell environment in the face of potentially conflicting application versions and libraries.

Default Setup

When a user logs in, the system looks for a file named .modules in their home directory. This file contains module commands to set up the initial shell environment.

Viewing Available Modules

The command

$ module avail

displays a list of all the modules available. The list will look something like:

--- some stuff deleted ---

---------------- /usr/local/packages/Modules/modulefiles/admin -----------------
EasyBuild/1.11.1       GCC/4.9.0              INTEL-140-MPICH/3.1.1
EasyBuild/1.13.0       INTEL/14.0.2           INTEL-140-MVAPICH2/2.0
--- some stuff deleted ---

The module names take the form appname/version/compiler, providing the application name, the version, and information about how it was compiled (if needed).

Managing Modules

Besides avail, there are other basic module commands to use for manipulating the environment. These include:

add/load mod1 mod2 ... modn . . . Add modules
rm/unload mod1 mod2 ... modn  . . Remove modules
switch/swap mod . . . . . . . . . Switch or swap one module for another
display/show  . . . . . . . . . . List modules loaded in the environment
avail . . . . . . . . . . . . . . List available module names
whatis mod1 mod2 ... modn . . . . Describe listed modules

The -h option to module will list all available commands.

Module is currently available only on SuperMIC.


bowtie --help  for command line options

e.g., bowtie2 -c prefix-index-file GCGTGAGCTATGAGAAAGCGCCACGCTTCC
      bowtie2 prefix-index-file reads.fq

      bowtie2-build seq.fna index-file 


Last modified: June 20 2015 11:20:48.